SciELO - Scientific Electronic Library Online

 
vol.16 número6Efecto del consumo de cultivo de levadura saccharomyces cerevisiae1026 y/o selenio en pollos de engorde expuestos a bajos niveles de aflatoxina b1 en la dieta: 1. Valores de proteínas séricas y actividad enzimática en sueroResiduos de enrofloxacina en tejido hepático y muscular de pollos beneficiados en el municipio san francisco del estado zulia, venezuela índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

Links relacionados

Bookmark

Revista Científica

versión impresa ISSN 0798-2259

Rev. Cient. (Maracaibo) v.16 n.6 Maracaibo dic. 2006

 

Identificación diferencial de aislados clínicos de mycobacterium tuberculosis y mycobacterium bovis por un ensayo de rcp múltiple.

Differential Identification of Mycobacterium tuberculosis and Mycobacterium bovis Clinical Isolates by Multiplex PCR Assay.

Nailet Arráiz1*, Zolay Romay2, Nelba Faría2 y Dámaso Mujica3

1 Centro de Investigaciones Endocrino-Metabólicas “Dr. Félix Gómez”, Sección de Biología Molecular, Facultad de Medicina, Universidad del Zulia. Maracaibo, Venezuela. E-mail: narraiz@cantv.net.

2 Coordinación del Programa Regional de Control de Tuberculosis, Laboratorio de tuberculosis, Servicio Autónomo Hospital Universitario de Maracaibo.

3 Facultad de Ciencias Veterinarias, Universidad del Zulia.

RESUMEN

Mycobacterium tuberculosis es el agente causal de tuberculosis en humanos, sin embargo, la transmisión zoonótica de Mycobacterium bovis de animales a humanos, principalmente a individuos inmunocomprometidos, es de gran impacto en salud pública. La necesidad de diseñar métodos rápidos y precisos que permitan diferenciar entre M. tuberculosis y M. bovis ha conducido al desarrollo de estrategias de identificación genotípica. El objetivo de este estudio fue evaluar el poder discriminatorio de un ensayo de reacción en cadena de la polimerasa en formato múltiple para diferenciar entre aislados clínicos de M. tuberculosis y M. bovis. Se estandarizaron condiciones para amplificación simultánea con oligonucleótidos dirigidos a secuencias de genes Rv0577 y Rv1510. Rv0577 es específico de micobacterias del Complejo M. tuberculosis y Rv1510 se localiza en regiones polimórficas (RD4) del genoma de cepas del complejo M. tuberculosis, ausentes en M. bovis y M. bovis BCG, permitiendo diferenciar entre estas dos especies del complejo M. tuberculosis. Para evaluar la especificidad del ensayo se analizaron 46 aislados clínicos. El amplicón correspondiente a Rv0577 se detectó en todos los aislados clínicos del complejo M. tuberculosis, mientras que el producto de 1033 pb Rv1510 (RD4), se observó exclusivamente en M. tuberculosis, pero no en M. bovis, ni en M. bovis BCG, demostrando la especificidad de este ensayo de RCP para identificar micobacterias del complejo M.tuberculosis y diferenciar entre M. tuberculosis y M. bovis en una única reacción de amplificación. Dada la especificidad del ensayo, éste puede ser aplicado para la identificación y diferenciación de micobacterias del complejo M. tuberculosis en muestras clínicas, para hacer control de calidad de productos derivados de animales con sospechas de infección y desarrollar estudios a gran escala de transmisión zoonótica de M. bovis en poblaciones vulnerables.

Palabras clave: M. tuberculosis, M. bovis, RCP múltiple, Rv1510, RD4, Rv0577.

ABSTRACT

Mycobacterium tuberculosis is the causal agent of tuberculosis in humans, however, the zoonotic transmission of Mycobacterium bovis from animals to humans, mainly immunocompromised individuals, is of great impact in public health. The necessity to design rapid and precise methods to differentiate between M. tuberculosis and M. bovis has lead to the development of strategies of genotypic identification. The aim of this study was to evaluate the discriminatory power of a multiplex PCR assay to differentiate between M. tuberculosis and M. bovis clinical isolates. Conditions for simultaneous amplification with oligonucleótidos targeted Rv0577 and Rv1510 genes sequences were standardized. Rv0577 is specific of M. tuberculosis complex mycobacteria and Rv1510 is located in polymorphic regions (RD4) of the mycobacterial genome of M. tuberculosis complex, but is absent in M. bovis and M. bovis BCG, allowing to differentiate between M. tuberculosis complex strains. To evaluate the specificity of the PCR assay, 46 clinical isolates were analyzed. The amplicon from Rv0577 gene was detected in all of the clinical isolates from M. tuberculosis complex, whereas the 1033 pb product from Rv1510 (RD4), was exclusively observed in M. tuberculosis and was absent in M. bovis and M. bovis BCG, showing the specificity of this PCR assay to identify mycobacteria of the M. tuberculosis complex and to differentiate between M. tuberculosis and M. bovis in a single-step assay. This multiplex PCR assay can be applied to the identification and differentiation of mycobacteria of M. tuberculosis complex in clinical samples, to the quality control of products derived from animals with infection suspicions and to develop studies on great scale of zoonotic transmission of M. bovis in susceptible populations.

Key words: M. tuberculosis, M. bovis, multiplex PCR, Rv1510, RD4, Rv0577.

Recibido: 08 / 06 / 2005.  Aceptado: 27 / 07 / 2006.

INTRODUCCIÓN

El complejo Mycobacterium tuberculosis comprende micobacterias de crecimiento lento causantes de tuberculosis en animales y humanos, difíciles de diferenciar por métodos bacteriológicos convencionales. El grupo incluye M. tuberculosis causante de tuberculosis en humanos; M. bovis que infecta principalmente el ganado bovino, pero también causa tuberculosis en humanos; M. bovis BCG, el derivado atenuado de la cepa de M. bovis comúnmente utilizado como vacuna de protección contra M. tuberculosis; M. africanum, especie causante de tuberculosis humana en el continente africano; M. microti, la cual es patogénica en roedores y M. canetti, una subespecie de M. tuberculosis reportada en tuberculosis humana [13,15, 29, 32]. A pesar de la definición de un rango relativo de hospedador, se conoce que ocurre transmisión zoonótica de todas estas especies de animales a humanos [1, 13, 15, 30], de hecho, la transmisión zoonótica de M. bovis de animales a humanos por el consumo de leche no pasteurizada y otros productos de animales infectados, tiene gran impacto en salud pública [3, 10, 11]. También se han reportado infecciones por M. bovis BCG en niños vacunados y pacientes con algún compromiso del sistema inmune e infectados por el virus HIV [4, 14, 25].

La infección por M. bovis tiene gran importancia desde el punto de vista terapéutico, debido a que su patrón de susceptibilidad a antibióticos difiere al de M. tuberculosis, por ejemplo, la mayoría de las cepas de M. bovis tienen resistencia natural a pirazinamida, una de las drogas de primera línea utilizadas en el tratamiento de la tuberculosis [19, 26], de manera que la identificación de aislados clínicos del complejo M. tuberculosis, particularmente la diferenciación entre especies M. tuberculosis y M. bovis es un aspecto clave para el tratamiento adecuado del paciente y para brindar información epidemiológica a las Coordinaciones de los Programas de Control de Tuberculosis. A pesar de la limitada información epidemiológica de la incidencia de la tuberculosis por M. bovis en el mundo, diversos reportes han señalado que la infección por M. bovis tiene gran impacto en salud pública en países de África, América Latina y el Caribe [1, 3, 10, 11, 36].

La inexistencia de métodos rápidos y precisos que permitan diferenciar entre M. tuberculosis y M. bovis ha conducido a diversos grupos de investigación a emplear la técnica de reacción en cadena de la polimerasa (RCP) para detectar diferencias genotípicas entre estas especies. Uno de los ensayos propuestos inicialmente, se diseñó basándose en el hecho de que M. tuberculosis contiene en su genoma mayor número de copias del elemento de inserción IS6110 que M. bovis, sin embargo, estudios posteriores demostraron que algunas cepas de M. bovis también tenían alto número de copias de IS6110 y a su vez, algunas cepas de M. tuberculosis exhibían bajo número de copias de este elemento de inserción [28]. Otro intento resultó del estudio del gen mtp-40, el cual presumiblemente estaba presente en M. tuberculosis y ausente en M. bovis [21], demostrándose luego que el gen estaba ausente en varias cepas de M. tuberculosis y presente en varias cepas de M. bovis [33]. En estudios posteriores se han incorporado otros marcadores genéticos para diferenciar entre M. tuberculosis y M. bovis [20, 23, 24, 35], destacándose el diseño de ensayos de RCP que se basan en la caracterización de polimorfismos de ADN que dependen de la presencia o no de regiones espaciadoras localizadas entre dos secuencias [6, 22, 27].

Diversos estudios comparativos utilizando estrategias de hibridación genética han puesto en evidencia estas regiones de diferenciación (RD), que representan pérdida de material genético en M. bovis en relación con M. tuberculosis H37Rv [7, 9, 12], de hecho, se ha propuesto que esto puede estar relacionado con el proceso de atenuación de M. bovis BCG (Bacilo Calmette-Guerin) [7]. Estas regiones de diferencia incluyen largas secuencias polimórficas (LSP) que parecen haberse acumulado secuencialmente y están diferencialmente distribuidas entre varios grupos de micobacterias del complejo tuberculosis [9, 12, 18]. Estas LSP se han utilizado recientemente para diferenciar entre varias cepas del complejo M. tuberculosis y establecer relaciones filogenéticas [16, 17, 22].

Dada la distribución diferencial de estas LSP en cepas del complejo Mycobacterium tuberculosis, en el presente estudio se evaluaron oligonucleótidos basados en secuencias RD4 [16] para diferenciar entre aislados clínicos de M. tuberculosis y M. bovis. Posteriormente estos oligonucleótidos se utilizaron en una RCP en formato múltiple para amplificar simultáneamente con otros oligonucleótidos específicos del género Mycobacterium y para el Complejo Mycobacterium tuberculosis.

MATERIALES Y MÉTODOS

Cepas de micobacterias

Se evaluaron 46 cepas micobacterianas aisladas de muestras de esputo provenientes de pacientes con clínica de tuberculosis, incluyendo 36 aislados clínicos de M. tuberculosis, 8 de M. bovis y 2 de M. bovis BCG. Los aislados clínicos fueron caracterizados por análisis fenotípico y características bioquímicas en el laboratorio de Diagnóstico de Tuberculosis con sede en el Servicio Autónomo del Hospital Universitario de Maracaibo (SAHUM), laboratorio de referencia que procesa muestras provenientes de todos los municipios del estado Zulia. Este laboratorio está adscrito al Programa Regional de Control de Tuberculosis.

Oligonucleótidos utilizados

Para la identificación de micobacterias M. tuberculosis, M. bovis y M. bovis BCG, pertenecientes al complejo M. tuberculosis, se utilizaron tres pares de secuencias que se indican en la TABLA I. Un par género-específico dirigido a la secuencia del gen ribosomal 16S (rDNA 16S) que permite detectar cualquier miembro del género Mycobacterium. Otro par, dirigido a la secuencia del marco de lectura identificado como Rv0577, se utilizó para identificar cepas del complejo M. tuberculosis y un tercer par de oligonucleótidos correspondiente a la secuencia del gen Rv1510, localizado en el locus RD4, presente en todas en las cepas del complejo M. tuberculosis, excepto en M. bovis [9, 12, 16], se utilizó para diferenciar entre M. tuberculosis y M. bovis. La identidad de estos oligonucleótidos fue confirmada por alineamiento de sus secuencias utilizando el programa Blastn y las Bases de Datos European Molecular Biology Laboratory (EMBL) del Centro Nacional de Información Biotecnológica de EUA (NCBI) y del Centro de Sanger, de los Proyectos de Secuenciación de los genomas de M. tuberculosis H37Rv.

TABLA I. OLIGONUCLEÓTIDOS UTILILIZADOS EN ESTE ESTUDIO / PRIMERS USED IN THIS STUDY

Nombre del oligoNT

Secuencia de nucleótidos

Gen

(Región amplificada)

Tamaño del producto

de RCP

Rv0577F

5’ ATGCCCAAGAGAAGCGAATACAGGCAA 3’

Marco de lectura de función desconocida

Complejo M. tuberculosis

(671949-671164)

786pb

Rv0577R

5’ CTATTGCTGCGGTGCGGGCTTCAA 3’

Rv1510F

5’ GTGCGCTCCACCCAAATAGTTGC 3’

Gen ubicado en región RD4

Ausente en M. bovis

(1702610-1701578)

1033pb

Rv1510R

5’ TGTCGACCTGGGGCACAAATCAGT C 3’

Rv16SrDNAF

5’ ACGGTGGGTACTAGGTGTGGGTTTC 3’

Gen de rDNA 16S

Género específico

(1472650-1473192)

543pb

Rv16SrDNAR

5’ TCTGCGATTACTAGCGACTCCGACTTCA 3’

Los oligonucleótidos fueron seleccionados de referencia 16 y sintetizados por Maxim Biotech, INC.

Extracción y purificación de ADN genómico de colonias de micobacterias

La extracción de ADN de colonias micobacterianas se llevó a cabo utilizando un procedimiento de lisis enzimática convencional [2] con algunas modificaciones. Se tomó una asada de una colonia micobacteriana, se transfirió a un tubo, se inactivó con calor a 90°C por 1 hora y se sometió a tratamiento con etanol a una concentración final de 70% por 6 horas para provocar muerte celular [34]. Esta suspensión se centrifugó a 14000 rpm por 5 minutos, se descartó el sobrenadante y el sedimento se resuspendió en 500 µL de Buffer TE (10 mM Tris-HCl, pH 8, 1mM EDTA, pH 8). Se agregaron 100 µL de lisozima 10mg/mL y se incubó a 37°C por 1 hora. Se agregaron 70 µL de SDS 10% y 10 µL de proteinasa K 10 mg/mL, se incubó a 65°C por 1 hora. Se hizo extracción con 500 µL de cloroformo y se centrifugó a 14.000 rpm por 5 minutos. La fase acuosa se transfirió a otro tubo y el ADN se precipitó con 500 µL de isopropanol. El ADN se resuspendió en 40 µL de buffer TE. Se utilizó 3 µL de la muestra para ensayos de amplificación.

Ensayos de amplificación por RCP

Para las reacciones de amplificación, se preparó la mezcla de reacción para un volumen final de 50 µL, consistiendo en 5 µL de buffer Taq DNA polimerasa (Promega), 1,5 mM MgCl2, 200µM cada desoxirribonucleótido (dATP, dCTP, dGTP y dTTP), 1 µL de cada oligonucleótido 10 µM (10 pmoles cada oligonucleótido). Se utilizó 0,25 µL de Taq DNA polimerasa 5U/µL para cada reacción (PROMEGA). Se ensayaron temperaturas de alineamiento en el rango de 52°C hasta 60°C para reacciones de amplificación con pares de oligonucleótidos individuales. Finalmente se seleccionó 58°C como temperatura de alineamiento óptima para la amplificación con todos los pares de oligonucleótidos ensayados. El programa de amplificación consistió en un paso de desnaturalización inicial de 5 minutos a 94°C y 30 ciclos de amplificación de 1 minuto a 94°C, 1 minuto a 58°C, 1 minuto a 72°C y un paso final de extensión a 72°C por 5 minutos. Las reacciones se llevaron a cabo en termociclador MJ Research PTC-100.

Los productos de RCP se analizaron en geles de agarosa al 1%. La corrida electroforética se llevó a cabo a 40v/cm por 1-3 horas. Los geles fueron teñidos y fotografiados con sistema de fotodocumentación DigiDoc UVP. Se utilizó marcador de peso molecular PCR markers de PROMEGA (1000, 750, 500, 300, 150 y 50 pb).

Como control negativo de amplificación se utilizó ADN genómico de bacterias Gram negativas (Escherichia coli) y Gram positivas (Staphylococcus aureus), procesadas en paralelo con las muestras de micobacterias, permitiendo monitorear especificidad y riesgos de contaminación.

RESULTADOS Y DISCUSIÓN

Se analizó un total de 46 aislados clínicos de micobacterias, incluyendo 36 cepas de M. tuberculosis, 8 de M. bovis y 2 de M. bovis BCG.

En una primera fase del análisis, el ADN extraído de todos los aislados clínicos se sometieron a una primera ronda de amplificación utilizando un ensayo de RCP duplex previamente estandarizado en el laboratorio que permite identificar cepas del complejo M. tuberculosis. El ensayo incluye oligonucleótidos género-específicos basados en la secuencia del gen ribosomal rDNA 16S que amplifican un segmento de 543 pb en el genoma de cualquier micobacteria. El otro par de oligonucleótidos está dirigido al marco de lectura Rv0577, un gen que está presente exclusivamente en el genoma del complejo M. tuberculosis y generan un fragmento de 786 pb (TABLA I).

Consistente con la especificidad de secuencias, al utilizar estos oligonucleótidos, se generaron dos bandas de tamaños esperados en todos los aislados clínicos analizados (FIGS. 1 y 2), confirmando que son micobacterias (fragmento de 543 pb) y que todas pertenecen al complejo M. tuberculosis (fragmento de 786 pb). En el caso de micobacterias no pertenecientes al complejo M. tuberculosis, solo amplifica la secuencia rDNA 16S (543 pb), identificación que es realizada de rutina en el laboratorio, pero no se aislaron micobacterias no tuberculosas en el presente estudio.

El mismo patrón de amplificación se observó en todas las cepas de crecimiento lento aisladas de pacientes con clínica de tuberculosis. Es importante destacar, que aun cuando se toman en consideración datos epidemiológicos, la decisión terapéutica en casos de tuberculosis pulmonar, siempre se inclina al tratamiento contra M. tuberculosis. Los antibióticos de primera línea contra M. tuberculosis incluyen: isoniazida, rifampicina y pirazinamida, sin embargo M. bovis tiene un patrón de susceptibilidad diferente y exhibe resistencia natural a pirazinamida [19, 26], por lo cual es de gran utilidad aplicar estrategias de identificación rápidas que garanticen un tratamiento oportuno y acertado del paciente.

La transmisión zoonótica de M. bovis a humanos se ha atribuido al contacto directo con animales infectados o el consumo de leche proveniente de estos animales [3, 10, 11, 36]. Adicionalmente en los pacientes infectados por HIV, se ha reportado coinfección con M. bovis BCG [14] y con M. bovis multirresistente a drogas [8, 14, 25].

Debido al lento crecimiento de estas micobacterias y a algunas limitaciones para diferenciarlas por técnicas convencionales, se han evaluado diversas técnicas de identificación basadas en características genotípicas [20-24, 28, 33, 35], sin embargo, también se han encontrado obstáculos debido a que los miembros del complejo M. tuberculosis, a pesar de variar en su potencial patogénico, localización geográfica y rango de hospedador exhiben un alto grado de conservación de secuencias en sus genomas y esta identidad de secuencia es principalmente notable entre M. tuberculosis y M. bovis [9]. Algunos ensayos para el diagnóstico de tuberculosis están disponibles comercialmente, sin embargo presentan algunas desventajas para propósitos de rutina como un mayor costo, técnicas adicionales de hibridación y lo más importante es que no distinguen entre M. tuberculosis y M. bovis [5, 31].

Dado el carácter polimórfico de las secuencias de las regiones RD entre varios miembros del complejo M. tuberculosis señaladas por diversos autores [7, 9, 12, 16-18, 22], en este trabajo se seleccionaron oligonucleótidos dirigidos al gen Rv1510 localizado internamente en la región de diferenciación RD4 del genoma de miembros del complejo M. tuberculosis [16]. Este locus RD4 está ausente en M. bovis [7, 12, 22], por lo cual se sintetizaron oligonucleótidos dirigidos a Rv1510 y se incorporaron en un formato de RCP múltiple para detectar micobacterias del complejo M. tuberculosis y simultáneamente diferenciar entre M. tuberculosis y M. bovis. Para validar el ensayo, las mismas muestras de ADN de los aislados clínicos que resultaron positivas para miembros del complejo M. tuberculosis en el análisis anterior (FIG. 1), se analizaron con el ensayo de RCP múltiple, incluyendo los oligonucleótidos para genes rDNA 16S, Rv0577 y Rv1510.

Confirmando lo reportado en la literatura, en la FIG. 2 puede observarse un amplicón de 1.033 pb correspondiente al gen Rv1510, exclusivamente en M. tuberculosis, pero no en M. bovis, ni en M. bovis BCG. La ausencia del fragmento de 1.033 pb revela la identidad de cepas de M. bovis y M. bovis BCG. Igualmente, la presencia del amplicón de 786 pb en todos los aislados clínicos (FIGS. 1 y 2), demuestra la utilidad del par de oligonucleótidos de Rv0577 para detectar cepas del complejo M. tuberculosis. Este fragmento de 786 pb tanto en las reacciones de RCP duplex, como múltiple, fue consistentemente más débil que las otras bandas a pesar de numerosos intentos de estandarización, incluyendo varias temperaturas de alineamiento e incremento en la concentración de oligonucleótidos.

La identificación diferencial entre M. tuberculosis y M. bovis se correlacionó 100% con los resultados obtenidos por técnicas fenotípicas y análisis bioquímicos convencionales, sin embargo, se requieren pruebas genotípicas adicionales para lograr la identificación entre M. bovis y M. bovis BCG. En estos casos, se debe tomar en cuenta aspectos epidemiológicos, debido a que el aislamiento de M. bovis fue predominantemente asociado a personas que laboran o viven en regiones de intensa actividad agropecuaria. Una de las cepas de M. bovis BCG fue aislada recientemente de una niña que desarrolló infección posterior a la aplicación del protocolo de inmunización, lo cual condujo a investigar y determinar que padecía un estado de inmunosupresión.

De acuerdo a los resultados obtenidos, la aplicación de estos ensayos en formatos duplex o múltiple representan una estrategia de diagnóstico rápida y específica para la detección de micobacterias y diferenciación entre especies M. tuberculosis y M. bovis, brindando beneficios invalorables al paciente al orientar un protocolo terapéutico eficaz y oportuno.

CONCLUSIONES

En este trabajo se demostró la especificidad de un ensayo de RCP en formato múltiple para identificar micobacterias del complejo M. tuberculosis y discriminar entre especies M. tuberculosis y M. bovis (incluyendo M. bovis BCG) en una única reacción de amplificación.

Los resultados de este estudio permiten proponer la aplicación de este protocolo de RCP para la identificación diferencial de cepas de M. tuberculosis, M. bovis y M. bovis BCG en muestras clínicas y también para ser incorporado en esquemas de control de calidad de productos lácteos y cárnicos de animales con sospechas de infección y estudios a gran escala de transmisión zoonótica de M. bovis en poblaciones vulnerables.

AGRADECIMIENTO

Al Consejo de Desarrollo Científico y Humanístico de la Universidad del Zulia por el cofinanciamiento de esta investigación (Programa CONDES N° CC-0241-02).

A la Oficina de Planificación del Sector Universitario (OPSU) por su contribución en el fortalecimiento y equipamiento del laboratorio de Biología Molecular del Centro de Investigaciones Endocrino-Metabólicas “Dr. Félix Gómez” de la Facultad de Medicina de la Universidad del Zulia.

REFERENCIAS BIBLIOGRÁFICAS

1. ABALOS, P.; RETAMAL, P. Tuberculosis: a re-emerging zoonosis?. Rev. Sci. Tech. 23: 583-594. 2004.         [ Links ]

2. AUSUBEL, F.M. Short Protocols in Molecular Biology. 2da Ed. John Wiley Sons, Inc. New York, USA. 680 pp. 1992.         [ Links ]

3. AYELE, W.Y.; NEILL, S.D.; ZINSSTAG, J.; WEISS, M.G.; PAVLIK, I. Bovine tuberculosis: an old disease but a new threat to Africa. Int. J. Tuberc. Lung Dis. 8: 924-937. 2004.         [ Links ]

4. BAROUNI, A.S.; AUGUSTO, C.; QUEIROZ, M.V.; LOPES, M.T.; ZANINI, M.S.; SALAS, C.E. BCG lymphadenopathy detected in a BCG-vaccinated infant. Braz J. Med. Biol. Res. 37: 697-700. 2004.         [ Links ]

5. BEAVIS, K.G.; LICHTY, M.B.; JUNGKIND, D.J.; GIGER, O. Evaluation of Amplicor PCR for direct detection of M: tuberculosis from sputum specimens. J. Clin Microbiol. 33: 2582-2585. 1995.         [ Links ]

6. BEGGS, M.L.; CAVE, M.D.; MARLOWE, C.; CLONEY, L.; DUCK, P.; EISENACH, K.D. Characterization of Mycobacterium tuberculosis complex direct repeat sequence for use in cycling probe reaction. J. Clin. Microbiol. 34: 2985-2989. 1996.         [ Links ]

7. BEHR, M.A.; WILSON, M.A.; GILL, W.P.; SALAMON, H.; SCHOOLNIK, G.K.; RANE, S.; SMALL, P.M. Comparative Genomics of BCG Vaccines by whole-genome DNA microarray. Science 284: 1520-1523. 1999.         [ Links ]

8. BLASQUEZ, J.; ESPINOSA DE LOS MONTEROS, L.E.; SAMPER, S.; MARTÍN, C.; GUERRERO, A.; COBO, J.; VAN EMBDEN, J.D.; BAQUERO, F.; GÓMEZ-MAMPASO, E. Genetic characterization of multidrug-resistant Mycobacterium bovis strains from a hospital outbreak involving human immunodeficincy virus-positive patients. J. Clin. Microbiol. 35: 1390-1393. 1997.         [ Links ]

9. BROSCH, R.; GORDON, S.V.; MARMIESSE, M.; BRODIN, P.; BUCHRIESER, C.; EIGLMEIER, K.; GARNIER, T.; GUTIERREZ, C.; HEWINSON, G.; KREMER, K.; PARSONS, L.M.; PYM, A.S.; SAMPER, S.; VAN SOOLINGEN, D.; COLE, S.T. A new evolutionary scenario for the Mycobacterium tuberculosis complex. Proc. Natl. Acad. Sci. USA, 99: 3684-3689. 2002.         [ Links ]

10. FRITSCHE, A.; ENGEL, R.; BUHL, D.; ZELLWEGER, J.P. Mycobacterium bovis tuberculosis: from animal to man and back. Int. J. Tuberc. Lung Dis. 8: 903-904. 2004.         [ Links ]

11. GIBSON, A.L.; HEWINSON, G.; GOODCHILD, T.; WATT, B.; STORY, A.; INWALD, J.; DROBNIEWSKI, F.A. Molecular epidemiology of disease due to Mycobacterium bovis in humans in the United Kingdom. J. Clin. Microbiol. 42: 431-434. 2004.         [ Links ]

12. GORDON, S.V.; BROSCH, R.; BILLAUT, A.; GARNIER, T.; EIGLMEIR, K.; COLE, S.T. Identification of variable regions in the genomes of tubercle bacilli using bacterial artificial chromosomes arrays. Mol. Microbiol. 32: 643-655. 1999.         [ Links ]

13. GUTIÉRREZ, M.; SAMPER, S.; JIMENEZ, M.S.; VAN EMBDEN, J.D.; MARÍN, J.F.; MARTÍN, C. Identification for spoligotyping of a caprine genotype in Mycobacterium bovis strain causing human tuberculosis. J. Clin. Microbiol. 35: 3328-3330. 1997.         [ Links ]

14. HESSELING, A.C.; SCHAAF, H.S.; VICTOR, T.; BEYERS, N.; MARAIS, B.J.; COTTON, M.F.; WIID, I.; GIE, R.P.; VAN HELDEN, P.; WARREN, R.M. Resistant Mycobacterium bovis Bacillus Calmette-Guerin disease: implications for management of Bacillus Calmette-Guerin Disease in human immunodeficiency virus-infected children. Pediatr. Infect. Dis. J. 5: 476-479. 2004.         [ Links ]

15. HORSTKOTTE, M.A.; SOBOTTKA, I.; SCHEWE, C.K.; SCAFER, P.; LAUFS, R.; RUSCH-GERDES, S.; NIEMANN, S. Mycobacterium microti llama-type infection presenting as pulmonary tuberculosis in a human immunodeficiency virus positive-patient. J. Clin. Microbiol. 39: 406-407. 2001.         [ Links ]

16. HUARD, R.C.; DE OLIVEIRA, L.C.; BUTLER, R.; VAN SOOLINGEN, D.; HO, J.L. PCR-based method to differentiate the subspecies of the Mycobacterium tuberculosis complex on the basis of genomic deletions. J. Clin. Microbiol. 41: 1637-1650. 2003.         [ Links ]

17. MOSTOWY, S.; COUSINS, D.; BEHR, M.A. Genomic interrogation of the dassie bacillus reveals it as a unique RD1 mutant within the Mycobacterium tuberculosis complex. J. Bacteriol.186: 104-109. 2004.         [ Links ]

18. MOSTOWY, S.; COUSINS, D.; BRINKMAN, J.; ARANAZ, A.; BEHR, M.A. Genomics deletions suggest a phylogeny for the Mycobacterium tuberculosis complex. J. Infect. Dis. 186: 74-80. 2002.         [ Links ]

19. NIEMANN, S.; RICHTER, E.; RUSCH-GERDES, S. Differentiation among members of the Mycobacterium tuberculosis complex by molecular and biochemical features: evidence for two pirazynamide-susceptible subtypes of M. bovis. J. Clin. Microbiol. 38: 152-157. 2000.         [ Links ]

20. PARK, H.; JANG, H.; KIM, C.; CHUNG, B.; CHAN, C.; PARK, S.K.; SONG, S. Detection and identification of Mycobacteria by amplification of the internal transcribed spacer regions with genus-and species-especific PCR primers. J. Clin. Microbiol. 38: 4080-4085. 2000.         [ Links ]

21. PARRA, C.A.; LONDOÑO, L.P.; DEL PORTILLO, P.; PATARROYO, M.E. Isolation, characterization and molecular cloning of a specific Mycobacterium tuberculosis antigen gen: identification of a species-specific sequence. Infect. Immun. 59: 3411-3417. 1991.         [ Links ]

22. PARSONS, L.M.; BROSCH, R.; COLE, S.T.; SOMOSKOVI, A.; LODER, A.; BRETZEL, G.; VAN SOOLINGEN, D.; HALE, Y.M.; SALFINGER, M. Rapid and simple approach for identification of Mycobacterium tuberculosis complex isolates by PCR-based genomic deletions analysis. J. Clin. Microbiol. 40: 2239-2345. 2002.         [ Links ]

23. PRABHAKAR, S.; MISHRA, A.; SINGHAL, A.; KATOCH, M.; THAKRAL, S.; TYAGI, J.S.; PRADSAD, H.K. Use of the hupB gene coding a histone-like protein of Mycobacterium tuberculosis as a target for detection and differentiation of M: tuberculosis and M. bovis. J. Clin. Microbiol. 42: 2724-2732. 2004.         [ Links ]

24. RODRIGUEZ, J.G.; MEJÍA, G.A.; DEL PORTILLO, P.; PATARROYO, M.E.; MURILLO, L.A. Specie-specific identification of Mycobacterium bovis by PCR. Microbiol. 141: 2131-2138. 1995.         [ Links ]

25. SAMPER, S.; MARTÍN, C.; PINEDO, A.; RIVERO, A.; BLÁSQUEZ, J.; BAQUERO, F.; VAN SOOLINGEN, D.; VAN EMBDEN, J.D. Transmission between HIV-infected patients of multidrug-resistant tuberculosis caused by Mycobacterium bovis. AIDS 11: 1237-1242. 1997.         [ Links ]

26. SCORPIO, A.; ZHANG, Y. Mutations in pncA, a gene encoding pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus. Nat. Med. 2: 662-667. 1996.         [ Links ]

27. VAN EMBDEN, J.D.; VAN GORKOM, D.T.; KREMER, K.; JANSEN, R.; VAN DER ZEIJST, B.A.; SHOULS, L.M. Genetic variation and evolutionary origin of the direct repeat locus of Mycobacterium tuberculosis complex bacteria. J. Bacteriol. 182: 2393-2401. 2000.         [ Links ]

28. VAN SOOLINGEN, D.; HAAS, P.E.; HERMANS, P.W.; GROENEN, P.M.; VAN EMBDEN, J.D. Comparison of various repetitive DNA elements as genetic markers for strain differentiation and epidemiology of Mycobacterium tuberculosis. J. Clin. Microbiol. 31: 1987-1995. 1993.         [ Links ]

29. VAN SOOLINGEN, D.; HOOGENBOEZEM, T.; DE HAAS, P.E.; HERMANS, P.W.; KOEDAM, M.A.; TEPPEMA, K.S.; BRENNAN, P.J.; BESRA, G.S.; PORTAELS F.; TOP, J.; SHOULS, L.M.; VAN EMBDEN, J.D. A novel pathogenic taxon of the Mycobacterium tuberculosis complex, Canetti: characterization of an exceptional isolated from Africa. Int. J. Syst. Bacteriol. 47:1236-1245. 1997.         [ Links ]

30. VAN SOOLINGEN, D.; VAN DER ZANDEN, A.G.; HAAS, P.E.; NOORDHOEK, G.T.; KIERS, A.; FOUDRAINE, N.A.; PORTAELS, F.; KOLK, A.H.; KREMER, K.; VAN EMBDEN, J.D. Diagnosis of Mycobacterium microti infections among humans by using novel genetic markers. J. Clin. Microbiol. 36: 1840-1845. 1998.         [ Links ]

31. VLASPODER, F.; SINGER, P.; ROGGEVEEN, C. Diagnostic value of a amplification method (Gen Probe) compared with that of culture for diagnosis of tuberculosis. J. Clin. Microbiol. 33: 2699-2703. 1995.         [ Links ]

32. WAYNE, L.G.; KUBICA, G.P. The Mycobacteria. In the P.H.A Sneath and J.G. Holt (Eds). Bergey’s manual of systematic bacteriology, The Williams Wilkins Co., Baltimore, Md. Vol. 2, 1435-1457 pp. 1992.         [ Links ]

33. WEIL, A.; PLIKAYTIS, B.B.; BUTLER, W.R.; WODLEY, C.I.; SHINNICK, T.M. The mtp40 gene is not present in all strain of Mycobacterium tuberculosis. J. Clin. Microbiol. 34: 2309-2311. 1996.         [ Links ]

34. WILLIAMS, D.L.; GILLIS, T.P.; DUPREE, W.G. Ethanol fixation of sputum sediments for DNA-based detection of Mycobacterium tuberculosis. J. Clin. Microbiol. 33: 1558-1561. 1995.         [ Links ]

35. ZUMÁRRAGA, M.; BIGI, F.; ALITO, A.; ROMANO, M.I.; CATALDI, A. A 12,7 Kb fragment of the Mycobacterium tuberculosis genome is not present in Mycobacterium bovis. Microbiol. 145: 893-897. 1999.         [ Links ]

36. ZUMÁRRAGA, M.J.; MARTIN, C.; SAMPER, S.; ALITO, A.; LATINI, O.; BIGI, F.; ROXO, E.; CICUTA, M.E.; ERRICO, F.; CASTRO, M.; CATALDI, A.; VAN SOOLINGEN, D.; ROMANO, M.I. Usefulness of Spoligotyping in molecular epidemiology of Mycobacterium bovis-related infections in South America. Microbiol. 145: 893-897. 1999.         [ Links ]